Original Article

IcaA Gene in Environmental Isolates of Biofilm Producing Staphylococcus aureus

Ismaal Jmia Abas

Department of Biology, College of Education in Qurina, University of Basrah. Basrah, Iraq

Corresponding Author’s Email: ismail.abbs@uobasrah.edu.iq

Abstract

Background: Biofilm-forming (BF) Staphylococcus aureus bacteria are a major environmental and health concern due to their role in antibiotic resistance and chronic infections. The presence of biofilm- associated genes, such as the IcaA gene, plays a significant role in biofilm formation and increases its virulence in the environment. Objectives: This study aims to isolate and identify biofilm-producing Staphylococcus aureus from environmental samples, detect the presence of the IcaA gene using polymerase chain reaction, compare different biofilm detection methods, and detect antibiotic resistance and its patterns in the isolates. Methods: One hundred and forty environmental samples were collected from various locations, including soil and wastewater. Staphylococcus aureus was isolated and identified by culturing on different media and then characterized using biochemical methods. Biofilm formation was detected using Congo Red agar and tube-based methods. The IcaA gene was detected molecularly using Polymerase Chain Reaction (PCR). Antibiotic susceptibility testing was performed using disk diffusion. Results: A total of 140 environmental samples, 55 isolates exhibited biofilm-forming potential. Thirteen of these isolates were identified as Staphylococcus aureus. Biofilm detection showed that 76.92% of the isolates were positive using the Congo Red agar method, and 23.07% were positive using the tube method. Polymerase chain reaction (PCR) results indicated that 4 of the 13 isolates (30.76%) carried the IcaA gene. Antibiotic susceptibility testing revealed high resistance to vancomycin, amoxicillin, and oxacillin, while high susceptibility was observed to gentamicin and amikacin. Conclusion: Environmental Staphylococcus aureus isolates exhibited a marked capacity for biofilm formation and antibiotic resistance. The presence of the IcaA gene confirmed the genetic basis for biofilm formation in some isolates. The tube method showed greater agreement with molecular detection compared to the Congo red agar method. Continued monitoring of environmental Staphylococcus aureus and biofilm-associated genes is recommended due to their role in antibiotic resistance and public health risks.

Keywords: Antibiotic Resistant; BF Gene; Congo Red; S. aureus; Virulence Factor

Introduction

The biofilm (BF) in S. aureus consists of the main materials in addition to the bacteria that are embedded in extracellular polymeric materials (Peng et al., 2022). BF in these bacteria contains polysaccharides, phospholipids, proteins, nucleic acids, and tetroic acid, in addition to other polymeric materials that are dissolved in a high-water content (85–95%) (Nasser et al., 2022)

According to earlier studies, BF-lifestyle is a never-ending cycle, and the five main stages of BF production are as follows: (I) Attachment: Whether on a biotic or abiotic surface, microbes are reversibly adsorbed to the surface through weak contacts (such as Van der Waals forces). (II) Colonization: Via greater hydrophilic/hydrophobic interactions mediated by flagella, pili, lipopolysaccharides, exopolysaccharides, collagen-binding adhesive proteins, etc., microorganisms are permanently adhered to the surface. (III) Development: Multilayered cells multiply and accumulate, producing and secreting exopolysacharide EPS (IV) Maturation: BF matures, forming a stable, three-dimensional community with pathways for distributing nutrients and signaling chemicals. (V) Active dispersal: Microbial cells are separated or detached in clumps because of interactions with intrinsic or extrinsic stimuli, and the dispersed cells subsequently colonize other sites (Sauer et al., 2022)

In this dynamic process, certain enzymes are engaged in dissolving and reconfiguring BF, leading to active dispersion of BF and subsequent surface recolonization in addition to partial matrix destruction (Wang et al., 2023). This result revealed that the development of BFs can lessen the susceptibility of microbes to antibiotics. Second, antibiotics can be transported via multidrug efflux pumps in BFs to minimize toxic buildup (Zhang et al., 2024). The intracellular adhesion (Ica). cluster (IcaA), which encodes the necessary proteins for polysaccharide synthesis intercellular adhesion (PIA), which mediates cell-to-cell adhesion, aids Staphylococcus species in the production of BFs (Pugazhendhi et al., 2022). Identification of the Ica locus in S. aureus isolates is crucial, and it would enhance the diagnostic process for selecting the most appropriate course of action when combined with the phenotypic identification of BF (Mohammed & Al-Iedani, 2020) This approach aligns with the objective of the current study, in which it aimed to evaluate the ability of S. aureus to produce BFs and compare these isolates according to the environment from which they were isolated.

Methodology Collection of Samples

About 140 environmental samples were collected from 12 sites, the most important includes: water treatment plants, college laboratories, marine and river sediment such as Tigris and Euphrates rivers., sewage, polluted soil in Basrah, Iraqi.

Identification of Bacteria

The bacterium S. aureus was diagnosed and identified by microscopy and phenotypic examination, biochemical tests were performed, and the bacteria were grown on Mannitol Salt Agar according to Moraes et al. (2021).

BFs Formation Tests

Assay via Congo Red Agar:

The S. aureus, which has the ability to form BFs, were detected using the Congo Red Agar method, where the plates were incubated at 37 °C for overnight (Paul et al., 2026)

Assay via Tube Method:

The identified bacteria were transferred to sterile glass test tubes containing Tryptic broth medium prepared according to the manufacturer's instructions. One percent glucose was added to the medium, and the dishes were incubated for 24 hours at 37°C. The samples were then drained, and the tubes were washed with phosphate-buffered saline. After drying, 1% crystal violet stain was applied for three minutes. Excess stain was discarded, and the tubes were rinsed with distilled water. The samples were inverted, dried, and the formation of BFs on the tube walls and bottoms was monitored (Taj et al., 2012).

Detection of IcaA Gene DNA Extraction

According to the manufacturer's instructions.

By using DNA extraction kit from Presto TM Mini gDNA Bacteria Kit- South Korea, bacterial DNA was extracted (this work was according to manufacturer's instructions)

  1. Bacterial cells were collected from an overnight culture by centrifugation at 10,000 rpm for 5 minutes.

  2. The cells were then resuspended in TE buffer.

  3. Lysozyme enzyme was added, and the sample was incubated at 37°C for 30 minutes for cell wall analysis.

  4. Protease lysis solution was added, and the sample was incubated at 56°C for 30 minutes.

  5. A phenol-chloroform mixture was added, and the sample was centrifuged to separate the phases.

  6. DNA was precipitated using cold ethanol.

  7. The DNA sample was washed with 70% ethanol and air-dried.

  8. The DNA was resuspended in nuclease-free water and stored at -20°C until polymerase chain reaction (PCR) analysis.

Detection of Adhesion IcaA Genes Using PCR

Primer sequences for IcaA gene:

Primers used for detection of the IcaA gene selected based on published sequences from previous molecular studies (Arciola et al., 2001) and verified using GenBank database to ensure specificity for Staphylococcus aureus. Primers synthesized by a commercial oligonucleotide company in Table 1.

Table 1: Shows Primer Sequence


Forward

TCTCTTGCAGGAGCAATCAA

Product size: 814 bp

Arciola et al., 2001

Reverse

TCAGGCACTAACATCCAGCA

PCR Master Mix:

Chromosomal DNA amplification was performed using Polymerase Chain Reaction (PCR) with a master mix prepared by Pioneer (South Korea). The master mix contained Taq DNA polymerase, dNTPs, magnesium chloride (MgCl), a reaction buffer, a stabilizer, and a tracer. A 25-µL final volume of PCR mix was prepared, containing 12.5 µL of the master mix, 1 µL of forward primer, 1 µL of reverse primer, 5 µL of DNA template, and nuclease-free water to complete the final volume (Kim et al., 2025).

PCR Program:

DNA amplification was performed using polymerase chain reaction (PCR) in a thermal cycler with the following program according to (Cheung & Otto, 2023)

  1. Initial DNA separation: 95°C for 5 minutes

  2. 35 cycles of:

    • DNA separation: 95°C for 30 seconds

    • Annealing: 55°C for 30 seconds

    • Extension: 72°C for 45 seconds

  3. Final extension: 72°C for 7 minutes

  4. Storage at 4°C

After the reaction was completed, electrophoresis was used to analyze the PCR products on a 1 percent agarose gel in 1X TBE buffer. The PCR products were seen under UV light.

Antibiotic Resistance

The antibiotic susceptibility of these bacteria on Mueller-Hinton agar using the disc diffusion method and adopted antibiotics in the process of detecting antibiotic resistance according to work requirements and in accordance with the specifications of the Institute for Clinical and Laboratory Standards, (Humphries et al., 2021) in order to determine the extent of resistance of the studied bacterial strains (Weinstein & Lewis, 2020). The antibiotic use in the study was listed in Table 2.

Table 2: List of Antibiotics in this Study


Antibiotic

Abbreviation

Concentration (µg/disc)

Type (Class)

Reference

Amoxicillin–clavulanic acid

AMC

20/10 µg per disc

Beta-lactam


(Humphries

et al., 2021)

Oxacillin

OX

10 µg/disc

Beta-lactam

Amoxicillin

AX

25 µg/disc

Beta-lactam

Vancomycin

VA

30 µg/disc

Glycopeptide

Gentamicin

GEN

10 µg/disc

Aminoglycoside

Amikacin

AK

30 µg/disc

Aminoglycoside

Ciprofloxacin

CIP

5 µg/disc

Fluoroquinolone

Azithromycin

AT

15 µg/disc

Macrolide

Tobramycin

TOB

10 µg/disc

Aminoglycoside

Ceftazidime

CAZ

30 µg/disc

Cephalosporin

Trimethoprim-sulfamethoxazole

SXT

1.25/23µg/disc

Sulfonamide

Polymyxin B

PB

300 Units/disc

Polymyxin

Tetracycline

TIC

30 µg/disc

Tetracycline

Doxycycline

DO

10 µg/disc

Tetracycline

Statistical Analysis

At a significance level of 0.05, all statistical analyses were performed using SPSS software (version 25) based on the Chi-Square test (Levesque, 2005).

Results and Discussion Environmental Samples Distribution

A total of 140 environmental samples were collected, including soil, wastewater from homes, wastewater from schools, and wastewater from colleges as shown in Table 3.

Table 3: Distribution of Environmental Samples


Sample Source

Number of Samples

Percentage (%)

Soil

33

23.5%

Household wastewater

43

30.7%

School wastewater

29

20.7%

College wastewater

35

25%

Total

140

100%

Isolation and Identification of Bacteria

The samples classified based on Microscopic examine by using Gram stain and colony color and morphology, biochemical tests (Gale & Gale, 2022). The results shown from 140 sample 49 was Gram negative and 91 Gram positive Table 4.

Table 4: Isolation and Identification of Bacteria


Total

Gram negative

Gram positive

140

49

91

Percentage

35%

65%

χ² = 12.6, p < 0.05

The results in Table 4 showed that Gram-positive bacteria were more prevalent than Gram-negative bacteria, at 65% and 35% respectively. Statistical analysis using the chi-square test confirmed a significant difference between the two groups (p < 0.05), indicating that Gram-positive bacteria were dominant in the environmental samples. The prevalence of Gram-positive bacteria may be attributed to the structural characteristics of their cell wall. This wall contains a thick layer of peptidoglycan, which protects them from environmental stresses such as drought, temperature fluctuations, and nutrient deficiencies. This helps them survive longer in soil and wastewater compared to Gram-negative bacteria (Omidi et al., 2021). These results are consistent with studies showing that Gram-positive bacteria are more commonly isolated from soil and wastewater due to their ability to adapt to environmental conditions and their high resistance to stress condition (Ajmal et al., 2021).

Biofilm Formation

The results showed from 91-gram positive bacteria 55 isolates ability to form BFs, and the number of S. aureus which able to form BFs isolates was 13 Table 5.

Table 5: Biofilm Formation


Total Gram-Positive Bacteria

No. of Isolates Ability to form Biofilm

No. of S. aureus which able to form Biofilm

91

55

13

χ² = 3.97, p < 0.05


The results of this study showed that 60.4% of the Gram-positive bacterial isolates were capable of forming biofilms. This indicates that biofilm formation is a common characteristic among Gram-positive bacteria obtained from environmental samples.

Biofilm formation is a crucial virulence factor, particularly in Staphylococcus aureus, as it enhances bacterial survival, antibiotic resistance, and the ability to endure harsh environmental conditions. Biofilm-forming bacteria have the ability to adhere to surfaces and protect themselves within an extracellular polymer matrix (Peng et al., 2022). The presence of 13 biofilm-producing Staphylococcus aureus isolates indicates that this species plays a significant role in biofilm formation among Gram- positive bacteria. This finding is consistent with numerous studies reporting that Staphylococcus aureus is one of the most common biofilm-forming bacteria, particularly in environmental and clinical isolates (Kadkhoda et al., 2020).

The significant statistical variation observed in this study indicates that biofilm formation is not randomly distributed among isolates and may be related to the characteristics of bacterial genera and species, as well as environmental factors.

Comparison of BF Detection Modalities in S. aureus

The results of the current study showed that the rates of BF detection of S. aureus bacteria by the CRA method were 76.92%, by the TM method, 23.07%, and the positive and negative result for both methods showed in Figure 1.

The results of the statistical analysis showed a significant difference between the CRA and TM methods (p < 0.05), indicating that the Congo red agar method is more accurate and sensitive in detecting biofilm formation in Staphylococcus aureus isolates. And these results, were agreed with these results (Khan et al., 2011) that the CRA method is easy to use and interpret, while the TM method is more accurate and has high sensitivity and specificity (Oliveira & Cunha, 2010).


image


Figure 1: Formation of BFs Using Congo Red Method (Positive)




image


Figure 2: Formation of BFs by the Tube Method (a, Strong; b, Medium; c, Weak)

Antibiotic Resistance in S. aureus

The study finds that there are no significant differences (p > 0.05) for antibiotic resistance between S. aureus isolates (Figure 2). The results of the current study showed that the isolates under study are resistant to Vancomycin (VA), reaching 92.30% Vancomycin is one of the most important broad- spectrum antibiotics, as it has an effective effect on many types of Gram-positive bacteria (Alharbi et al., 2025).

The results of the current study showed a very high resistance rate compared to many previous studies. This indicates that the emergence of vancomycin-resistant Staphylococcus aureus (VRSA) is a serious global public health problem, due to the widespread and inappropriate use of vancomycin in the treatment of methicillin-resistant Staphylococcus aureus (MRSA) infections (Girijan & Pillai, 2021). The high resistance observed in this study may be attributed to the overuse of antibiotics, horizontal gene transfer, and the bacteria's ability to form biofilms, which increases their antimicrobial resistance (Michaelis & Grohmann, 2023).

The results of the study showed that the resistance of the isolates under study to Amoxillin (AX) and Oxyacillin (OX) reached 100%. The reason for the resistance to these antibiotics may be due to the change in permeability of the outer membrane of the bacteria represented by the systems of flow pumps and the secretion of beta-lactamase enzymes (Hussein et al., 2024).

The results of current study also showed that the isolates were sensitive to the Gentamicin antibiotic by 100%, and Amikacin (AK) by 92.30%, These results indicate that aminoglycoside antibiotics retain their efficacy against Staphylococcus aureus isolates in the study area. The high sensitivity observed with gentamicin and amikacin may be attributed to their limited use compared to other commonly used antibiotics, thus reducing the development of bacterial resistance (Thy et al., 2023). For the antibiotic Azithromycin the isolates under study show resistance to about 15.38%. It is considered one of the antibacterial growth inhibitors because it inhibits bacterial protein synthesis and is effective against most gram-positive bacteria (Sandman & Iqbal, 2024).

As for the resistance to the Ciprofloxacin (CIP) antibiotic, it was 46.15%, These findings are consistent with several previous studies that have demonstrated the increasing resistance of Staphylococcus aureus to fluoroquinolones. These reports have shown that ciprofloxacin resistance rates range from 30% to 70% in different regions (Awayid & Qassim Mohammad, 2022; Afzal et al., 2021; Mohammadi et al., 2020), depending on the local epidemiological situation and antibiotic use patterns. it may be due to the high sensitivity of this antibiotic, which is a quinolones antibiotic, as it is characterized by its rapid absorption and high penetration into cells and is characterized by its effectiveness in killing bacteria in a short period of time by inhibiting DNA replication (Tang & Zhao, 2023).

The current study showed that the isolates under study exhibited high sensitivity to the antibiotic Gentamicin 100%, Tobramycin and Amikacin, at rates of 100% and 92.3% respectively, observed in this study indicates that aminoglycosides remain highly effective against these isolates, The role of aminoglycosides and their antibacterial effect is achieved by inhibiting protein synthesis through binding to the 30S ribosomal subunit, leading to the killing of bacterial cells (Tang & Zhao, 2023).

The isolates under study showed moderate resistance to tetracycline antibiotics groups, with approximately 50% resistance to Tetracycline and 23.1% to Doxycycline. The presence of tetracycline- resistant pathogens may be attributed to the use of these drugs in treating diseases. Tetracycline resistance is often attributed to the acquisition of new genes, either genes responsible for the energy- based outflow of tetracycline from the cell, or genes responsible for a protein that protects bacterial ribosomes from the effects of tetracycline (Colaco et al., 2021).


image


Figure 3: Diagram of Percentage of Antibiotic Resistance of S. aureus Isolates (R: Resistance, S: Sensitive, I: Intermediate)

PCR Detection of IcaA Gene

The results of this study showed that 4 out of 13 isolates (30.7%) carried the IcaA gene (Figure 3). The IcaA gene is closely related to biofilm formation, as it is part of the IcaADBC operon, which is responsible for the synthesis of intercellular adhesive polysaccharides (PIAs), essential components in biofilm formation and bacterial adhesion (Ahmad et al., 2022). The percentage obtained in the current study (30.7%) falls within the range indicated by several previous studies, where the prevalence of the IcaA gene varies considerably among Staphylococcus aureus isolates. A systematic review and meta- analysis showed that the prevalence of Ica operon genes ranges from 28% to 51.5%, and that the average prevalence of the IcaA gene is approximately 38.4%, ranging from 3.1% to 80% depending on the sampling source and geographic region (Bamneshin et al., 2024). A study conducted on animal feed sources revealed that the percentage of IagA gene in Staphylococcus isolates was approximately 45%, which is close to the results of the current study (Sharan et al., 2024).

On the other hand, some studies have shown very high prevalence rates of the IcaA gene, especially among clinical and multidrug-resistant isolates, with prevalence rates reaching 90% and possibly higher in some MRSA isolates, indicating a strong correlation between biofilm formation, virulence, and antibiotic resistance (Alibegli et al., 2025).


image

2000


1000

Figure 4: Agarose Gel Electrophoresis of PCR-Amplified IcaA Gene in Staphylococcus aureus Isolates

The Expected Amplicon Size is 814 bp. Lane M Represents the 100 bp DNA Ladder, while Lanes 1–4 Show Positive Amplification of the IcaA Gene

The PCR analysis confirmed the presence of the IcaA gene in selected S. aureus isolates, as evidenced by the clear amplification bands at 814 bp (Figure 4). This finding supports the role of the IcaA gene in biofilm formation and highlights its contribution to the virulence and persistence of environmental isolates. The detection of this gene further correlates with the observed biofilm-forming ability and may explain the increased resistance patterns reported in this study.

Limitation

One limitation of this study is the relatively small number of Staphylococcus aureus isolates analyzed for molecular detection of the IcaA gene, which may limit the generalizability of the findings. Additionally, only a single biofilm-associated gene (IcaA) was investigated, whereas other genes involved in biofilm formation were not assessed.

Instruction for AI Assistance Declaration

The author hereby declares that, during the preparation of this manuscript, generative AI tools such as ChatGPT, Microsoft Copilot, and Google Gemini were utilized to assist with language enhancement and grammar correction. Following the use of these tools, the author thoroughly reviewed and revised the content and takes full responsibility for the final version of the manuscript, ensuring its accuracy and adherence to the required academic standards.

Conclusion

The presence of the IcaA gene in environmental isolates of BF-producing S. aureus highlights the adaptability and significance of this gene in various ecological contexts. Understanding its role is essential for both clinical and environmental perspectives, as it sheds light on antibiotic resistance mechanisms and microbial interactions within natural ecosystems. Further research is warranted to explore the full scope of IcaA's impact on biofilm formation and its implications for public health and environmental science

Conflict of Interest

The authors declare that there are no conflicts of interest related to this study.

Acknowledgement

The author is grateful to Department of Biology, College of Education- Qurna, University of Basrah, Iraq.

References

Afzal, M., Vijay, A. K., Stapleton, F., & Willcox, M. D. (2021). Susceptibility of ocular Staphylococcus aureus to antibiotics and multipurpose disinfecting solutions. Antibiotics, 10(10), 1203. https://doi.org/10.3390/antibiotics10101203

Ahmad, S., Rahman, H., Qasim, M., Nawab, J., Alzahrani, K. J., Alsharif, K. F., & Alzahrani, F. M. (2022). Staphylococcus epidermidis pathogenesis: Interplay of IcaAdbc operon and mscramms in biofilm formation of isolates from pediatric bacteremia in Peshawar, Pakistan. Medicina, 58(11), 1510. https://doi.org/10.3390/medicina58111510

Ajmal, A. W., Saroosh, S., Mulk, S., Hassan, M. N., Yasmin, H., Jabeen, Z., ... & Mumtaz, S. (2021). Bacteria isolated from wastewater irrigated agricultural soils adapt to heavy metal toxicity while maintaining their plant growth promoting traits. Sustainability, 13(14), 7792. https://doi.org/10.3390/su13147792

Alharbi, O. S., Alhazmi, K. A., Gazzaz, M., Almuhayya, S., Aldehalan, F. A., Sharif, A. T., ... & Ibrahem, K. (2025). A review vancomycin role in Gram Positive biofilm-associated infections: challenges and emerging solutions. Therapeutics and Clinical Risk Management, 1569-1578. https://doi.org/10.2147/TCRM.S541780

Alibegli, M., Bay, A., Fazelnejad, A., Ghezelghaye, P. N., Soghondikolaei, H. J., & Goli, H. R. (2025). Contribution of IcaADBC genes in biofilm production ability of Staphylococcus aureus clinical isolates collected from hospitalized patients at a burn center in North of Iran. BMC Microbiology, 25(1), 302. https://doi.org/10.1186/s12866-025-04018-z

Arciola, C. R., Baldassarri, L., & Montanaro, L. (2001). Presence of IcaA and icaD genes and slime production in a collection of staphylococcal strains from catheter-associated infections. Journal of Clinical Microbiology, 39(6), 2151–2156. https://doi.org/10.1128/jcm.39.6.2151-2156.2001

Awayid, H. S., & Qassim Mohammad, S. (2022). Prevalence and Antibiotic Resistance Pattern of Methicillin-Resistant Staphylococcus aureus Isolated from Iraqi Hospitals. Archives of Razi Institute, 77(3). https://doi.org/10.22092/ARI.2022.357391.2031

Bamneshin, K., Poudineh, M., Alibabaei, R. H., Amiri, M. R. J., Fateminasab, Z. S., Ghorbani, Z., Maleki, R., & Khaledi, A. (2024). Prevalence of IcaADBC genes, and correlation with biofilms and antibiotic resistance in S. aureus: a systematic review and meta-analysis. Germs, 14(4), 387. https://doi.org/10.18683/germs.2024.1448

Cheung, G. Y., & Otto, M. (2023). Virulence mechanisms of staphylococcal animal pathogens. International Journal of Molecular Sciences, 24(19), 14587. https://doi.org/10.3390/ijms241914587

Colaco, H. G., Barros, A., Neves-Costa, A., Seixas, E., Pedroso, D., Velho, T., Willmann, K. L., Faisca, P., Grabmann, G., & Yi, H.-S. (2021). Tetracycline antibiotics induce host-dependent disease tolerance to infection. Immunity, 54(1), 53–67. https://doi.org/10.1016/j.immuni.2020.09.011

Gale, M. S., & Gale, B. D. S. M. (2022). Diagnosis: fundamental principles and methods. Cureus, 14(9). https://doi.org/10.7759/cureus.28730

Girijan, S. K., & Pillai, D. (2021). Identification and characterization of vancomycin-resistant Staphylococcus aureus in hospital wastewaters: evidence of horizontal spread of antimicrobial resistance. Journal of Water and Health, 19(5), 785-795. https://doi.org/10.2166/wh.2021.117

Humphries, R., Bobenchik, A. M., Hindler, J. A., & Schuetz, A. N. (2021). Overview of changes to the clinical and laboratory standards institute performance standards for antimicrobial susceptibility testing, M100. Journal of Clinical Microbiology, 59(12), 10-1128. https://doi.org/10.1128/jcm.00213-21

Hussein, R. A., Al-Kubaisy, S. H., & Al-Ouqaili, M. T. (2024). The influence of efflux pump, outer membrane permeability and β-lactamase production on the resistance profile of multi, extensively and pandrug resistant Klebsiella pneumoniae. Journal of Infection and Public Health, 17(11), 102544. https://doi.org/10.1016/j.jiph.2024.102544

Kadkhoda, H., Ghalavand, Z., Nikmanesh, B., Kodori, M., Houri, H., Maleki, D. T., Bavandpour, A. K., & Eslami, G. (2020). Characterization of biofilm formation and virulence factors of Staphylococcus aureus isolates from paediatric patients in Tehran, Iran. Iranian Journal of Basic Medical Sciences, 23(5), 691. https://doi.org/10.22038/ijbms.2020.36299.8644

Khan, F., Shukla, I., Rizvi, M., Mansoor, T., & Sharma, S. C. (2011). Detection of biofilm formation in Staphylococcus aureus. Does it have a role in treatment of MRSA infections? Trends in Medical Research, 6(2), 116–123. https://doi.org/10.3923/tmr.2011.116.123

Kim, D. H., Joo, M. S., Jang, S. R., Kim, H. J., Min, J. G., & Nam, B. H. (2025). Impact of Antibiotic Exposure on Growth and Biofilms Formation in Aeromonas salmonicida Subspecies Isolated from Atlantic Salmon (Salmo salar). Microorganisms, 13(12), 2863. https://doi.org/10.3390/microorganisms13122863

Levesque, R. (2005). SPSS programming and data management: a guide for SPSS and SAS users. Spss. https://dl.acm.org/doi/abs/10.5555/1199139

Michaelis, C., & Grohmann, E. (2023). Horizontal gene transfer of antibiotic resistance genes in biofilms. Antibiotics, 12(2), 328. https://doi.org/10.3390/antibiotics12020328

Mohammadi, M., Bahrami, N., Khajavian, M., & Faghri, J. (2020). The Occurrence of Type I, II, and III Integrons in Multi-drug Resistance and Methicillin-Resistant Staphylococcus aureus Isolates in Iran: M. Mohammadi et al. Current Microbiology, 77(8), 1653-1659. https://doi.org/10.1007/s00284-020-01956- x

Mohammed, A. L., & Al-Iedani, A. A. (2020). Molecular detection of ica gene and some surface proteins in biofilm producer of methicillin-resistant and methicillin-sensitive Staphylococcus aureus. Biochemical & Cellular Archives, 20. https://faculty.uobasrah.edu.iq/uploads/publications/1619436104.pdf

Moraes, G. F. Q., Cordeiro, L. V., & de Andrade Júnior, F. P. (2021). Main laboratory methods used for the isolation and identification of Staphylococcus spp. Revista Colombiana de Ciencias Químico- Farmacéuticas, 50(1), 5-28. https://doi.org/10.15446/rcciquifa.v50n1.95444

Nasser, A., Dallal, M. M., Jahanbakhshi, S., Azimi, T., & Nikouei, L. (2022). Staphylococcus aureus: biofilm formation and strategies against it. Current Pharmaceutical Biotechnology, 23(5), 664-678. https://doi.org/10.2174/1389201022666210708171123

Oliveira, A., & Cunha, M. D. L. R. (2010). Comparison of methods for the detection of biofilm production in coagulase-negative staphylococci. BMC Research Notes, 3(1), 260. https://doi.org/10.1186/1756- 0500-3-260

Omidi, A. H., Sabati, H., Amini, S., Zonobian, M. A., & Mohammadi, M. R. (2021). Staphylococcus aureus in the environment of healthcare centers. Cellular, Molecular and Biomedical Reports, 1(4), 147- 157. https://doi.org/10.55705/cmbr.2021.403541.1156

Paul, A. J., Chandra, M., Kaur, G., Narang, D., & Gupta, D. K. (2026). Isolation and Characterization of Staphylococcus aureus and Its Biofilm Implicated in Bovine Mastitis. Indian Journal of Microbiology, 1– 13. https://doi.org/10.1007/s12088-026-01542-y

Peng, Q., Tang, X., Dong, W., Sun, N., & Yuan, W. (2022). A review of biofilm formation of Staphylococcus aureus and its regulation mechanism. Antibiotics, 12(1), 12. https://doi.org/10.3390/antibiotics12010012

Pugazhendhi, A. S., Wei, F., Hughes, M., & Coathup, M. (2022). Bacterial adhesion, virulence, and biofilm formation. In Musculoskeletal Infection (pp. 19-64). Cham: Springer International Publishing. https://doi.org/10.1007/978-3-030-83251-3_2

Sandman, Z., & Iqbal, O. A. (2024). Azithromycin. StatPearls [Internet].

Sauer, K., Stoodley, P., Goeres, D. M., Hall-Stoodley, L., Burmølle, M., Stewart, P. S., & Bjarnsholt, T. (2022). The biofilm life cycle: expanding the conceptual model of biofilm formation. Nature Reviews Microbiology, 20(10), 608-620. https://doi.org/10.1038/s41579-022-00767-0

Sharan, M., Dhaka, P., Bedi, J. S., Mehta, N., & Singh, R. (2024). Assessment of biofilm-forming capacity and multidrug resistance in Staphylococcus aureus isolates from animal-source foods: implications for lactic acid bacteria intervention. Annals of Microbiology, 74(1), 22. https://doi.org/10.1186/s13213-024-01768-5

Taj, Y., Essa, F., Aziz, F., & Kazmi, S. U. (2012). Study on biofilm-forming properties of clinical isolates of Staphylococcus aureus. The Journal of Infection in Developing Countries, 6(05), 403–409. https://doi.org/10.3855/jidc.1743

Tang, K., & Zhao, H. (2023). Quinolone antibiotics: resistance and therapy. Infection and Drug Resistance, 811–820. https://doi.org/10.2147/IDR.S401663

Thy, M., Timsit, J. F., & de Montmollin, E. (2023). Aminoglycosides for the treatment of severe infection due to resistant gram-negative pathogens. Antibiotics, 12(5), 860. https://doi.org/10.3390/antibiotics12050860

Wang, S., Zhao, Y., Breslawec, A. P., Liang, T., Deng, Z., Kuperman, L. L., & Yu, Q. (2023). Strategy to combat biofilms: a focus on biofilm dispersal enzymes. NPJ Biofilms and Microbiomes, 9(1), 63. https://doi.org/10.1038/s41522-023-00427-y

Weinstein, M. P., & Lewis, J. S. (2020). The clinical and laboratory standards institute subcommittee on antimicrobial susceptibility testing: background, organization, functions, and processes. Journal of Clinical Microbiology, 58(3), 10-1128. https://journals.asm.org/doi/full/10.1128/jcm.01864-19

Zhang, L., Tian, X., Sun, L., Mi, K., Wang, R., Gong, F., & Huang, L. (2024). Bacterial efflux pump inhibitors reduce antibiotic resistance. Pharmaceutics, 16(2), 170. https://doi.org/10.3390/pharmaceutics16020170